Recherche

Compteur Visiteurs

Compteur Global gratuit sans inscription

Lutte Anti Braconnage

Montage créé avec bloggif

Travaux Pratiques Elevage

Montage créé avec bloggif

Visiteurs/Pays

Flag Counter

MAP

Map

Diappo. Photo

Montage créé avec bloggif

Salon Avicole International de Yaoundé 2014

Montage créé avec bloggif

Facebook Like

 

juin 2017
L Ma Me J V S D
« avr    
 1234
567891011
12131415161718
19202122232425
2627282930  

Exercices, TD, Examens

De François Djitie KouatchoEmail : fk.djitie@univ-ndere.cm

elevage-2013-1014.jpg

Exercice de Parasitologie

1-    Qu’est-ce qu’un vecteur? donner  04 exemples avec des maladies causées.

2-    qu’est-ce qu’un hôte intermédiaire, donnez 04 exemples

3-    Donnez 02 amibes libres de genres différents ainsi que les principaux moyens de contamination

4-    Qu’est-ce qu’un parasite hétéroxène? donner  04 exemples.

5-    Donner les noms scientifiques et les maladies causées par des larves des cestodes humaines et de bovins et porcins.

6-    Donner les caractères morphologiques des différentes espèces du plasmodium.

7-    Cysticercose : mode de contamination, signes cliniques et  prophylaxie.

8-    Schémas annotés de 02 parasites responsables de maladies sexuellement   transmissibles.

9-    Caractères morphologiques différentiels des principales espèces plasmodiales.

10-    Cycle biologique d’un p. responsable de la bilharziose urogénitale?

11-    Définition de champignon filamenteux, levuriforme, et dimorphique. Pour chacun d’eux donnez le Nom Scientifique de 2 espèces appartenant à des genres différents?

12-    Cycle évolutif du parasite responsable de l’échinococcose alvéolaire.

13-    Donnez le nom scientifique de 04 nématodes transmis par un vecteur.

14-    Donner un nématode nécessitant un hôte intermédiaire dans son cycle.

15-    Citez pour chacun d’eux le nom du vecteur correspondant et l’hôte intermédiaire incriminé.

QCM

16-     Quelles sont les différentes formes d’amibiase à Entamoeba histolytica ?

A.      intestinale

B.      cardiaque

C.      pulmonaire

D.     rénale

E.      hépatique

17-            Quels examens aident au diagnostic d’une oxyurose ?

A.                  NFS

B.                  Test de Graham

C.                  ECBU

D.                 Sérologie

E.                  Examen parasitologique des selles

18-            Quels sont les hôtes de Fasciola hepatica ?

A.                  Herbivores

B.                  Volailles

C.                  Bovins

D.                 Poissons

E.                  Carnivores

19-            Quels sont les signes cliniques d’une phase d’invasion par Fasciola hepatica ?

A.                  asthénie

B.                  douleurs abdominales

C.                  diarrhées

D.                 vomissements

E.                  colique hépatique

20-           Dans quels organes s’effectue le cycle de Schistosoma mansoni ?

A.                  système porte

B.                  intestin

C.                  cœur

D.                 estomac

E.                  vessie

21-           Quels sont les différents modes de contamination par Entamoeba histolytica ?

A.                  les crudités

B.                  les rapports sexuels

C.                  les aliments souillés par des mouches

D.                 la transfusion

E.                  l’eau minérale en bouteille

22-           Par quels examens peut-on faire le diagnostic d’une giardiose ?

A.                  Sérologie

B.                  Examen parasitologique des selles

C.                  Tubage duodénal

D.                 Biopsie pulmonaire

23-           Quels sont les traitements d’une oxyurose ?

A.                  Flagyl

B.                  Pentacarinat

C.                  Fluvermal

D.                 Povanyl

E.                  Zentel

24-           Quels signes cliniques peuvent évoquer une contamination par Cryptosporidium parvum ?

A.                  diarrhées aiguës

B.                  vomissements

C.                  cachexie

D.                 déshydratation

E.                  douleurs abdominales

25-           Quelles sont les techniques de diagnostic d’une cryptosporidiose ?

A.                  Examen parasitologique des selles

B.                  Coloration de Ziehl-Neelsen modifiée sur biopsie intestinale

C.                  Détection des anticorps dans le sang

D.                 Détection des antigènes du tissu par anticorps monoclonaux

E.                  Technique d’Anatomo-pathologie sur biopsie

26-            Quelles sont les zones d’endémie du paludisme ?

A.                  Australie

B.                  Mexique

C.                  Nouvelle Zélande

D.                 Inde

E.                  Afrique

27-           Quelles sont les conditions nécessaires au développement des anophèles ?

A.                  Température de 30°C

B.                  Canicule à 45°C

C.                  Humidité importante

D.                 Soleil

E.                  Vent

28-           Quelle est la période d’incubation de Plasmodium falciparum ?

A.                  1 jour

B.                  6 jours

C.                  12 jours

D.                 21 jours

E.                  30 jours

29-           Quels peuvent être les signes cliniques d’une infection à Plasmodium falciparum ?

A.                  fièvre seule

B.                  splénomégalie

C.                  thrombopénie

D.                 encéphalite

E.                  convulsions

30-           Quels sont les différents stades de Trichomonas vaginalis ?

A.                  trophozoïtes

B.                  mérozoïtes

C.                  kystes

D.                 oocystes

E.                  gamétocytes

31-           Quelles sont les complications possibles lors d’une infection à Ascaris lumbricoïdes ?

A.                  occlusion intestinale

B.                  péritonite

C.                  pancréatite

D.                 hépatite

E.                  cholécystite

32-           Quels sont des différents stades du cycle de l’anguillule ?

A.                  œufs éliminés dans les selles

B.                  larve rhabditoïde dans les selles

C.                  larve strongyloïde dans les selles

D.                 Contamination par ingestion de la larve strongyloïde infestante

E.                  Contamination par passage transcutané de la larve strongyloïde infestante

33-            Quels sont les différents examens aidant au diagnostic d’une anguillulose ?

A.                  NFS répétées

B.                  Examen parasitologique des selles avec MIF

C.                  Coproculture

D.                 Technique de Baerman

E.                  Test de Graham

34-           Quelle est la morphologie de Fasciola hepatica ?

A.                  adulte de 15cm avec 1 ventouse

B.                  adulte de 3cm avec 2 ventouses

C.                  adultes en forme de feuille

D.                 œufs operculés

E.                  œufs de 50µm de long

35-           Quel est l’hôte intermédiaire de Schistosoma mansoni ?

A.                  la limnée

B.                  la planorbe

C.                  le bulin

D.                 l’onchomelania

E.                  le phlébotome

36-           Quelle est la répartition géographique de Schistosoma mansoni ?

A.                  le Brésil

B.                  les Antilles

C.                  l’Afrique du sud

D.                 l’Australie

E.                  le Danemark

37-           Quels sont les signes évocateurs d’une infection à Schistosoma mansoni ?

A.                  hématurie

B.                  asthénie

C.                  diarrhées

D.                 ascite

E.                  granulomes dans les tissus à la radiographie

38-           Quels sont les examens permettant le diagnostic d’une bilharziose ?

A.                  imagerie

B.                  NFS

C.                  Détection des antigènes par immunofluorescence indirecte

D.                 Sérologie

E.                  Biopsie rectale

39-           Quel est le traitement d’un taeniasis ?

A.                  Flagyl

B.                  Fluvermal

C.                  Trédémine

D.                 Biltricide

E.                  Graines de courges

40-           Quelle est la répartition géographique d’Echinoccocus granulosus ?

A.                  Amérique du sud

B.                  Afrique du nord

C.                  nouvelle Zélande

D.                 bassin méditerranéen

E.                  Australie

41-           Quels sont les différents types d’hydatidose que l’on peut rencontrer ?

Hydatidose hépatique

Hydatidose splénique

Hydatidose pulmonaire

Hydatidose neuro-méningée

Hydatidose oculaire

42-           L’amibiase due à Entamoeba histolytica :

A. la contamination se fait par des kystes

B. on distingue une forme minuta et une forme histolytica

C. la forme minuta est peu pathogène

D. se caractérise par son noyau avec une fine couronne de chromatine et son caryosome

E. le kyste peut contenir jusqu’à 2 noyaux et peut renfermer des corps sidérophiles

43-           L’amibiase due à Entamoeba histolytica :

A. la forme histolytica contient des hyaluronidases

B. peut être confondu avec Entamoeba dispar

C. 1 kyste donne 4 petites amibes dans la lumière colique

D. dans les cas graves, on peut avoir des atteintes hépatiques, pulmonaires, cérébrales, de la rate

E. la colite méta-amibienne se traite avec des fortes doses d’antiparasitaires

44-           L’amibiase due à Entamoeba histolytica :

A. l’amibiase hépatique peut survenir plusieurs semaines à plusieurs mois après la contamination

B.                  on peut avoir des glaires sanglantes dans les selles

C.                  le diagnostic d’amibiase hépatique repose essentiellement sur des examens d’imageries

D. la sérologie se fait par IFI, agglutination et la confirmation par électrosynérèse

E. le traitement des formes intestinales associe du métronidazole et INTETRIX pendant 3 jours

45-           Giardia intestinalis :

A. est un flagellé du tube digestif

B. le trophozoïte possède 2 noyaux

C. le trophozoïte possède 8 flagelles partant du blépharoplaste

D. le trophozoïte possède un vrai axostyle et au centre un appareil parabasal

E. le kyste possède 2 à 4 noyaux

46-           Giardia intestinalis :

A. est un parasite qui évolue au niveau du duodénum

B. se multiplie par scissiparité

C. il suffit de 3 à 4 kystes pour développer une symptomatologie

D. le traitement repose sur des imidazolés

E. peut être responsable de retards de croissance

47-           Trichomonas vaginalis :

A. possède 1 noyau

B. est muni de 2 axostyles

C. possède 4 flagelles libres antérieurs

D. possède 1 flagelle récurrent avec une membrane ondulante

E. le kyste est la forme infestante

48-           Trichomonas vaginalis :

A. peut se transmettre par des gants de toilettes humides

B. peut se retrouver chez la femme au niveau des glandes de Bartholin et de Skene

C. peut se retrouver au niveau de la prostate chez la femme

D. peut entraîner des dyspareunies

E. sont des éléments à cytoplasme bleu et noyau violet au MGG

49-           Les cryptosporidies :

A. sont des zoonoses

B. appartiennent aux Apicomplexa

C. la forme infestante est l’oocyste qui contient 4 sporozoïtes, 1 vacuole mais pas de corps résiduel

D. on peut se contaminer par inhalation

E. possède un cycle qui passe par une schizogonie, une gamogonie puis une gamétogonie

50-            Les cryptosporidies :

A. peuvent être rencontrées dans les diarrhées des voyageurs

B. peuvent se multiplier au niveau de la vésicule biliaire

C. peuvent se multiplier au niveau des poumons

D. la technique de coloration de choix est le MGG

E. peuvent se traiter par CRYPTASE

51-            L’oxyurose :

A. est due à un trématode appelé Enterobius vermicularis

B. le mâle mesure de 3 à 5 cm

C. les œufs sont directement infestant

D. peuvent conduire à des manifestations génitales

E. le diagnostic est apporté par le test de Graham

52-            L’oxyurose :

A. on peut avoir une hyperéosinophilie à 20% dans certains cas

B. un des traitements proposés est le Fluconazole TRIFLUCAN

C. un des traitements proposé est le Flubendazole (FLUVERMAL)

D. un des traitements proposé est l’Albendazole (ZENTEL)

E. il faut recommencer le traitement 3 jours après

53-           l’ascaridiose :

A. n’est pas un parasite exclusif de l’homme

B. l’adulte mesure une vingtaine de centimètres

C. les œufs se caractérisent par leur double coque, la plus externe étant mamelonnée

D. il peut exister des œufs non fécondés

E. les œufs sont embryonnés à la ponte

54-           Cliniquement, l’ascaridiose peut conduire à :

A. une occlusion intestinale

B. des perforations intestinales avec péritonites

C. des migrations aberrantes

D. des pancréatites

E. des méningo-encéphalites

55-           L’anguillulose :

A. l’adulte parasite est une femelle parthogénétique non hématophage

B. possède 2 cycles de développement différents selon les conditions extérieures

C. possède un cycle endogène sans larve L2

D. peut être mise en évidence par une coproculture dite de Baerman

E. peut conduire à un syndrome de larva curens

56-           La distomatose :

A. est aussi appelée fasciolose

B. peut être mis en évidence par la présence d’œufs de 20 µm dans les selles contenant des cellules vitellines

C. l’hôte intermédiaire est la limnée

D. l’hôte intermédiaire est le phlébotome

E. la période d’incubation est de 15 jours

57-           La distomatose :

A. les œufs ne sont pas retrouvés dans les selles avant 3 mois après la contamination

B. peut entraîner une hyperéosinophilie à la phase d’état à 20 G/l

C. le diagnostic peut être immunologique

D. le traitement de choix est le triclabendazole (FASINEX)

E. le parasite peut vivre 10 ans chez l’homme

58-           la bilharziose à Schistosoma mansoni :

A. l’hôte intermédiaire est une planorbe du nom de Biomphalaria

B. est présente en Amérique et en Asie, mais pas en Afrique noire

C. l’œuf possède un éperon terminal

D. il y a un phénomène de polyembryonie

E. peut se révéler par des manifestations au niveau du système nerveux

59-           L’espèce Candida :

A. seul C. albicans est positif au test de filamentation en 3 heures

B. est le genre mycosique le plus fréquemment rencontré dans les septicémies

C. quelques espèces donnent des chlamydospores en 24 heures

D. C. albicans présente généralement des résistances aux antifongiques habituellement utilisés

E. nécessite des milieux riches pour pousser in vitro

60-           Les dermatophytes :

A. M. canis peut parasiter le chien, mais pas le chat

B. T. mentagrophytes se rencontre chez des rongeurs

C. E. floccosum est un parasite fréquent du bétail

D. T. rubrum se rencontre exclusivement dans l’espèce humaine

E. seuls certains dermatophytes sont responsables de la « roue de St Catherine »

61-           A l’examen direct, les dermatophytes :

A. doivent être colorés au MGG

B. forment des filaments non cloisonnés mais ramifiés

C. il y a une atteinte microïde avec T. mentagrophytes

D. les souches autochtones de T. rubrum sont souvent stériles

E. la griséofulvine doit être prise en dehors des repas

))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))

Exercice de Biologie Moléculaire

Exercice 1:
1. Définir: Amplicon, ARN-Polymérase, Marqueur de poids moléculaire, Translocation.

2. Pour chaque élément cité, donner son rôle et son site d’action sur l’ADN : température, hélicase, enzyme de restriction.

Exercice 2:
Suite à la catastrophe nucléaire de Fukushima au Japon, Mr Wong présente des troubles physiologiques. L’analyse du cytoplasme cellulaire de ce dernier révèle 70% d’ARN pré messager et 30% d’ARNm mature ainsi que la dispersion de ses chromosomes dans le cytoplasme. On vous demande :
a- Quel phénomène biologique majeur pourrait être à l’origine de ces troubles ? pourquoi ?
b- Quel élément cellulaire semble selon vous avoir été affecté ? pourquoi ?
c- Lequel des ARN n’est pas à sa place ? justifier votre réponse
d- Dans un tableau à 2 colonnes, comparer (localisation, composition aptitude à la traduction) ces deux ARN
e- Quelle technique pourrait après extraction, permettre de transférer ces ARN pour étude ? quelle autre technique exige-t-il ?
f- Donner le rôle des ARN intervenant dans traduction.
g- Apres un éventuel traitement, quels pourcentages de ces deux ARN devraient-t-on avoir dans le cytoplasme ? est-t-il normal de trouver de l’ARNm mature dans un noyau eucaryotique ? pourquoi ?

Exercice 3 : maturation des ARNm
Ci-joint une représentation schématique de la structure d’un gène isolé de plantes.
exo-3.JPG
(E=exon et I=intron)

a- Nommer et définir l`élément ( ?) en amont du 1er exon
b- Que représente le symbole // en avant de l’exon 4 ?
c- Quelle différence faites-vous entre exon et intron
d- En le considérant comme étant un ARN pré messager, représenter sur le schéma la position et l’écriture du codon d’initiation et du codon stop
e- Décrire le comportement du ribosome sur le codon initiateur, l’intron I3 et le codon stop pendant la synthèse des protéines
f- Schématiser les structures du pré-ARNm et de l’ARNm mature formés à partir de ce gène
g- Une mutation étant survenue au niveau du site d’épissage situé au début de l’intron 3 l’a rendu
inconnu par la machinerie d’épissage. Donner la structure de l’ARNm qui dérive de ce gène.
h- Quel est la conséquence si cette mutation est non-sens ?

Exercice 4: Questions à Choix Multiples (QCM)

QCM1.

Quelle est la proposition fausse concernant la molécule ARNm d’une cellule eucaryote ?
a) Elle code plusieurs protéines tout à fait différentes
b) Est le résultat d’un processus de maturation du RNA prémessager
c) Elle possède une queue poly-adénylée
d) Elle peut être traduite simultanément par plusieurs ribosomes
QCM2.

Choisir la proposition fausse concernant la transcription
a) La coiffe protège l’ARNm des dégradations dues aux nucléases
b) L’épissage fait intervenir des ribonucléoprotéines spécifiques
c) L’épissage des mRNA constitue le mécanisme d’ajout de la coiffe
d) Les ARNm eucaryotes sont polyadénylés (coté 3’).

QCM3.

Les bactéries ne détruisent pas leur DNA par leurs propres enzymes de restriction parce qu’elles lui ajoutent …..?…..:
a) Des peptides b) Des di-déoxy nucléotides c) Des groupes méthyl d) Du glycophosphate

QCM4.

Parmi les propositions relatives à la PCR, laquelle est inexacte ?
a) Elle nécessite la répétition de cycles alternant dénaturation, hybridation et synthèse.
b) C’est une technique d’amplification du DNA in vitro.
c) Elle nécessite l’utilisation d’amorces RNA.
c) Elle nécessite une polymérase thermostable.

QCM5.

Lors du clonage d’un gène, les fragments de DNA peuvent s’hybrider avec les plasmides qui ont été coupés avec la même enzyme:
a) Vrai. b) Faux. c) juste dans le cas où le plasmide est bicaténaire d) aucune réponse n’est juste.

QCM6.

Sortir l’intrus a) Cytosine b) Thymine c) Uracile d) Adénine
QCM7.

Sortir l’intrus a) Base b) Sucre c) Phosphate d) Groupement méthyl
QCM8.

Les endonucléases coupent les liaisons Phosphodiester en bout de chaîne.
a) Vrai b) Faux c) juste pendant la maturation de l’ARNm
QCM9.

La technique de PCR (Polymerase Chain Réplication) permet d’amplifier du fragment d’ADN
a) Vrai b) Faux

QCM10.

Les boucles sont des motifs élémentaires en forme d’épingles de cheveux qui participent à stabiliser la structure secondaire des ARNr a) Vrai b) Faux

François Djitie Kouatcho fk.djitie@univ-ndere.cm

Les corrections seront faites en discussions aux commentaires ou données par mail à la demande et GRATUITEMENT

*****************************************************************************************************

Exercice de Biologie Moléculaire (2)

Par François Djitie Kouatcho fk.djitie@univ-ndere.cm

EXERCICE 1

Soient les enzymes suivantes : ADN polymérase, ARN polymérase, Hélicase, ADN ligase,
Topo- isomérase, RNAase H, : classez les par ordre d’intervention dans le phénomène de réplication

EXERCICE 2 : QCM choisir les propositions justes

Question 1

Un marqueur de poids moléculaire sert à :
a) Colorer la préparation à analyser
b) Cliver l’échantillon d’ADN en des sites spécifiques
c) Estimer la taille des différents fragments sur l’électrophorégrame

Question 2

Un plasmide possédant 3 sites de restriction pour HindIII donne après digestion :
a) 1 fragment b) 2 fragments c) 3 fragments d) 4 fragments
Question 3. Au cours de la maturation du mRNA eucaryotique, il ya :
a) Capping, épissage et polyadénilation b) dénaturation, hybridation et élongation
Question 4.

Choisir la proposition fausse concernant le mRNA et la traduction
a) La région codante du mRNA commence au codon initiateur (AUG) et se termine au codon stop (UAA, UGA et UAG).
b) Les régions du mRNA appelées leader (coiffe 5′) et queue 3′ sont toutes des régions codantes.
c) Les ribosomes se déplacent sur le mRNA dans le sens 5′=>3′.

Question 5.

Que comporte un tRNA qui se fixe sur mRNA ?
a) Anticodon b) Codon c) Acide aminé d) Extrêmité 5′

Question 6.

Choisir la proposition fausse relative à la traduction
a) Le codon initiateur (AUG) code pour la méthionine qui se détache plus tard de la chaîne peptidique.
b) Un code dégénéré (redondant) signifie l’existence de plusieurs codons qui codent pour un seul acide aminé.
c) Au niveau du mRNA, la séquence de codons qui va du codon start (codon initiateur) à la queue 3′
polyadénylée constitue le cadre de lecture.

Question 7.

Une protéine de 600 acides aminés découle de :
a) 200 codons au plus b) 1800 codons exactement c) 600 codons au moins

Par François Djitie Kouatcho fk.djitie@univ-ndere.cm

Les corrections seront faites en discussions aux commentaires ou données par mail à la demande et GRATUITEMENT

************************************************************************************************************

Exercice de Biologie Moléculaire (3)

Par François Djitie Kouatcho fk.djitie@univ-ndere.cm

Exercice 1: Questions de cours

a. Définir : réplication, transcription, traduction, maturation de l’ARNm, translocation, promoteur.

b. Quelle différence faites-vous entre un nucléoside et un nucléotide ?

c. Quelle différence faites-vous entre une base purique et une base pyrimidique ? donnez des exemples dans chaque cas.

d. Quels sont les constituants d’un monomère d’ARN ? représenter ses différentes bases azotées ?

e. Quelle différence existe-t-il entre les pentoses de l’ADN et de l’ARN ?

f. Dans un tableau, faites la différence entre une molécule d’ADN et d’ARN (composition, structure, fonction)

g. Citer et donner la fonction des 05 principales enzymes intervenant dans le mécanisme de la réplication.

h. Quelles sont les étapes de la transcription ?

i. En quoi consiste la maturation de l’ARNm chez les procaryotes et eucaryotes ?

j. Quels sont les éléments nécessaires à la synthèse protéique ? donner le rôle de chacun d’eux?

k. Quelles sont les caractéristiques du code génétique ?

l. Quelles peuvent être les fonctions d’un codon ?

m. Définir mutation. Citer et expliquer les différents types de mutation.

n. Donner le rôle et le principe des techniques de Biologie Moléculaire suivantes.

PCR, ELISA Électrophorèse, séquençage, Southern Blot

o. Donner les étapes de la PCR ainsi que les constituants nécessaires pour sa réalisation

p. Définir clonage. Donner la procédure de production de l’insuline suivant cette méthode.

q. Donner l’importance de la biologie moléculaire en Médecine, Agronomie, et en Criminologie.

Exercice 2:

La séquence d’un peptide bactérien est déterminée par la séquence suivante dans l’ADN :

5’pTTAAGCTAAGTAATTGCTACCAT3’OH

a. donner la séquence de l’ARNm correspondant en précisant la nature des extrémités

b. à l’aide du code génétique, indiquer la séquence du peptide obtenu après traduction.

c. en précisant la nature de ses deux extrémités, donner la séquence de l’anticodon correspondant à l’avant dernier acide aminé synthétisé.

d. trouve-t-on une illustration de la dégénérescence du code génétique dans la chaine traduite ? pourquoi ?

e. Une mutation ayant transformé le T (en gras dans la séquence) en G, quel sera la nouvelle séquence peptidique traduite ? quel est ce type de mutation ?

Exercice 3:

a. Donner la formule développée et le nom du trinucléotide suivant : ApUpGp

b. Écrire la formule développée de l’ATP en solution à pH 7. En déduire sa charge globale à ce pH.

Exercice 4:

Calculer le poids moléculaire moyen d’un résidu nucléotidique dans l’ADN. On supposera que les quatre résidus nucléotidiques existent en quantités équimolaires.

Données : Guanine : 151 g/mol; Cytosine : 111 g/mol; Thymine : 126 g/mol; Adénine : 135 g/mol; Désoxyribose : 134 g/mol; Acide phosphorique :98 g/mol

Exercice 5:

Soit un ADN double brin de masse moléculaire 4,5. 106daltons.

Calculer le nombre de paires de bases, la longueur, le nombre de tours d’hélice de cette molécule d’ADN.

On donne : pas de l’hélice d’ADN = 3,4 nm ; nombre de pb par tours d’hélice = 10 ; masse moléculaire moyenne d’un nucléotide =308 Da.

Par François Djitie Kouatcho fk.djitie@univ-ndere.cm

*******************************************************************************************************

Exercice de Biologie Moléculaire (4)

Par François Djitie Kouatcho fk.djitie@univ-ndere.cm

Exercice 1:

1. Définir: Promoteur, Translocation, ARNt.

2. Citer et définir les principaux phénomènes biologiques faisant intervenir les acides nucléiques.

3. Donnez les deux différences fondamentales existants entre la traduction des procaryotes et des eucaryotes.

Exercice 2: Questions à Choix Multiples (QCM)

QCM1. Quel est (ou quels sont) le(s) triplet(s) nucléotidique(s) du (ou des) anti-codon(s) du (ou des) ARNt Glu s’appariant avec les codons de l’acide glutamique GAA et GAG?

a. CUU b. CUC c. UUC d. TTC e. CTC

QCM2. Parmi les codons suivants quels sont les 2 qui correspondent au codon d’initiation de la traduction d’unepart et à l’un des codons de terminaison de chaîne protéique d’autre part?

a. AUC b. AUG c. UAG d. GAU e. UAC

QCM3. La séquence nucléotidique de l’anticodon d’un ARNt est la suivante: 5′-CCU-3′. Quelle est dans la séquence suivante d’un ARNm le triplet nucléotidique qui pourra s’apparier à l’anticodon?

qcm3.JPG

a. A b. B c. G d. D e. E

QCM4.

Parmi les propositions suivantes concernant l’ARNm eucaryotique, lesquelles sont exactes?

a. Elle débute par un codon AUG. b. elle est formée uniquement d’exons.

c. Elle porte une coiffe à l’extrémité 5′ et une queue de polyA à l’extrémité 3′OH

d. Elle contient toujours un codon stop.

QCM5. Une molécule d’ADN bicaternaire a une masse moléculaire (MM) de 3.08 x 105 Da. Sachant que la MM d’un nucléotide est de 308 Da. Quelle est le nombre de pb de cet ADN?

a. 1000 b. 500 c. 100 d. 50

QCM6. Dans l’ADN, indiquez le ou les couple(s) de trinucléotide(s) complémentaire(s) en tenant compte des conventions d’écriture des séquences (c’est-à-dire de 5′ vers 3′)

a. AAC et GTT b. AAC et TTG c. CAT et GTA d. CAT et ATG e. CTA et GAT

QCM7. Dans un programme PCR, quelle température choisiriez-vous pour l’étape d’élongation ?

a- 94°C b- 72°C c- 37°C d- 60°C

QCM8. Le bromure d’éthidium permet :

a- de dénaturer l’ADN b- d’extraire les ARN des tissus

c- de visualiser les acides nucléiques d- de dégrader spécifiquement l’ADN

QCM9. La digestion d’un DNA par une enzyme de restriction a permis l’obtention de 3 fragments A, B et C de tailles différentes (voir figure). Séparés par électrophorèse sur gel d’agarose 1,5%, le profile attendu correspondra à:

qcm.JPG

a) Profile 1. b) Profile 2.c) Profile 3. d) Profile 4. e) Profile 5.

QCM10. Choisir la (les) réponse (s) juste (s).

Pendant la réplication de l’ADN in vivo :

a) a) les nouvelles chaînes d’ADN commencent toujours avec une amorce d’ARN

b) le brin tardif est constitué par les fragments Okazaki*

c) les erreurs sont éliminées par une activité 5’-3’ exonucléase

d) la RNase H enlève les fragments d’Okazaki

Par François Djitie Kouatcho fk.djitie@univ-ndere.cm


Créer un Blog | Nouveaux blogs | Top Tags | 76 articles | blog Gratuit | Abus?