Recherche

Compteur Visiteurs

Compteur Global gratuit sans inscription

Lutte Anti Braconnage

Montage créé avec bloggif

Travaux Pratiques Elevage

Montage créé avec bloggif

Visiteurs/Pays

Flag Counter

MAP

Map

Diappo. Photo

Montage créé avec bloggif

Salon Avicole International de Yaoundé 2014

Montage créé avec bloggif

Facebook Like

 

mars 2015
L Ma Me J V S D
« fév   avr »
 1
2345678
9101112131415
16171819202122
23242526272829
3031  

Fiche Travaux Pratiques Parasitologie Tropicale

mars 28th, 2015 by Dr Djitie Kouatcho

Télécharger la fiche version pdf ici: travaux-pratiques-de-parasitologie-tropicale-m1boa-2015.pdf

Posted in Uncategorized | Réagir »

TRAVAUX DIRIGES: BASES FONDAMENTALES DE LA BIOLOGIE MOLECULAIRE

mars 10th, 2015 by Dr Djitie Kouatcho

TRAVAUX DIRIGES  ET PRATIQUES DE BASES FONDAMENTALES DE LA BIOLOGIE MOLÉCULAIRE L2BO
 

Télécharger fiche pour le TP ici:  tp-bf-biologie-moleculaire-l2bo-2015.pdf

PARTIE1 : Questions de cours
1- Quelle différence faites-vous entre une base purique et une base pyrimidique ? donnez des exemples dans chaque cas.
2- Donnez les constituants d’un monomère d’ARN puis représentez ses différentes bases azotées.
3- Quelle différence faites-vous entre un nucléoside et un nucléotide ?
4- Faites la différence entre les pentoses de l’ADN et de l’ARN ?
5- Dans un tableau, faites la différence entre une molécule d’ADN et d’ARN (composition, structure, fonction).
6- Définir : réplication, transcription, traduction, maturation de l’ARNm, translocation, promoteur.
7- Citez et donner la fonction des 05 principales enzymes intervenant dans le mécanisme de la réplication.
8- Citez et décrivez les différentes étapes de la transcription ?
9- En quoi consiste la maturation de l’ARNm chez les procaryotes et eucaryotes ?
10- Quelles sont les caractéristiques du code génétique ?
11- Quelles peuvent être les fonctions d’un codon ?
12- Définir mutation. Citer et expliquer les différents types de mutation.
13- Donner le rôle et le principe des techniques de Biologie Moléculaire suivantes.
PCR, Electrophorèse, séquençage, Southern Blot.
14- Donner les étapes de la PCR ainsi que les constituants nécessaires pour sa réalisation.
15- Quels sont les éléments nécessaires à la synthèse protéique ? donner le rôle de chacun d’eux?

PARTIE 2 : Exercices d’application
Exercice 1
La séquence d’un peptide bactérien est déterminée par la séquence suivante dans l’ADN :
5’PTTAAGCTAAGTAATTGCTACCAT3’OH
a) donner la séquence de l’ARNm correspondant en précisant la nature des extrémités
b) à l’aide du code génétique, indiquer la séquence du peptide obtenu après traduction.
c) en précisant la nature de ses deux extrémités, donner la séquence de l’anticodon correspondant à l’avant dernier acide aminé synthétisé.
d) trouve-t-on une illustration de la dégénérescence du code génétique dans la chaine traduite ? pourquoi ?
e) Une mutation ayant transformé le T (position 15 et en gras dans la séquence) en G, quel sera la nouvelle séquence peptidique traduite ? en déduire le type de mutation ?

Exercice 2
L’action de BamHI sur un plasmide donne 4 fragments ( ABCD) après electrophorèse sur gel d’agarose.
a. quelle est la fonction de BamHI ?
b. que signifie l’obtention de ces 4 fragments?
c. representer l’electrophoregramme :
- si les fragments sont tous de tailles differentes
- si deux de ces fragments sont de tailles égales.
d. Que signifirait la présence d’une seule bande sur l’électrophoregramme ? en deduire la carte de restriction de ce plasmide.

Exercice 3 : maturation des ARNm
Ci-joint une représentation schématique de la structure d’un gène isolé d’un échantiollon.
(E=exon et I=intron)

gene.JPG

a- nommer et définir l`élément ( ?) en amont du 1er exon
b- que représente le symbole // après l’exon 4 ?
c- quelle différence faites-vous entre exon et intron
d- représenter sur le schéma la position et l’écriture du codon d’initiation et du codon stop.
e- décrire le comportement du ribosome sur le codon initiateur, l’intron i3 et le codon stop pendant la synthèse des protéines.
f- schématiser les structures du pré-ARNm et de l’ARNm mature formés à partir de ce gène.
g- une mutation survient au niveau du site d’épissage situé au début de l’intron 3 le rendant
inconnu par la machinerie d’épissage. Donner la structure de l’ARNm qui dérivera de ce gène.
h- Quel est la conséquence si cette mutation est non-sens ?
Exercice 4 :
Et si on ne voulait plus laver le ‘Ndolè’
Exercice 5 :
Vous voulez étudier un fragment d’ADN de 536 paires de base correspondant à la région
régulatrice située en amont (5′) du gène de votre protéine favorite. Cette séquence est la
suivante :
Brin sens : 5′ GATTCAGGAGATTCACAC- -500 nucléotides- -TCGGTACAGCTATACAGG 3′
Brin antisens: 3′ CTAAGTCCTCTAAGTGTG- -500 nucléotides- -AGCCATGTCGATATGTCC 5′

Parmi les 8 amorces suivantes quelles sont les 2 amorces (à désigner par leurs lettres) qui permettront l’amplification par PCR de ce fragment ?
a) 5′GATTCAGGAGATTCACAC3′
b) 5′CTAAGTCCTCTAAGTGTG3′
c) 5′CACACTTAGAGGACTTAG3′
d) 5′TCGGTACAGCTATACAGG3′
e) 5′AGCCATGTCGATATGTCC3′
f) 5′GTGTGAATCTCCTGAATC3′
g) 5′CCTGTATAGCTGTACCGA3′
h) 5′GGACATATCGACATGGCT3

Exercice 6 :
SOIT UNE SÉQUENCE CODANTE DE 18NUCLEOTIDES.
transcription1.JPG

a. déterminer le sens de transcription. Justifier.
b. orienter l’ARNm, les deux brins de la molécule d’ADN et compléter le tableau.
c. orienter la chaîne polypeptidique en précisant les extrémités NH2et COOH-terminales.

Bon travail

Posted in Exerxices, Cours | 2 Commentaires »

Bases Fondamentales de la Biologie Moléculaire (L2BO 2015) Travail Personnel de l’Étudiant

mars 5th, 2015 by Dr Djitie Kouatcho

UNIVERSITE DE NGAOUNDERE                                                                                    THE UNIVERSITY OF NGAOUNDERE

      FACULTE DES SCIENCES                                                                                                  FACULTY OF SCIENCE

                                                                                    

                                                   DEPARTEMENT DES SCIENCES BIOLOGIQUES

                                                                 Année académique 2014/2015

              

Bases Fondamentales de la Biologie Moléculaire (L2BO)

Travail Personnel de l’Étudiant

NB : Respecter scrupuleusement le canevas de rédaction d’un TPE

1-                  Les modifications post transcriptionnelles

2-                  Les mutations et conséquences des mutations dans la traduction

3-                  Le code génétique et ses caractéristiques

4-                  Comparez macromolécules informationnelle et molécules du vivant

5-                  Extraction et purification des acides nucléiques

6-                  L’électrophorèse sur gel d’agarose

7-                  Les enzymes de restriction

8-                  Le Southern blot

9-                  Le Northern blot

10-             La Polymerase Chain Reaction (PCR)

11-             Les vecteurs de clonage

12-             Le clonage

13-             Le Principe du séquençage de Sanger

14-             Les différents types de test ELYSA

15-             Le Randomly amplified polymorphic DNA (RAPD)

16-             L’ Amplified fragment-length polymorphism (AFLP)

17-             Restriction Fragment length Polymorphism (RFLP)

18-             Les Microsatellites en biologie moléculaire

19-             Comparez les structures des ribosomes procaryotiques et eucaryotiques

20-             L’électrophorèse SDS-PAGE

Les groupes et listes doivent être en ordre alphabétique.   Délai de dépôt : lundi 16 Mars

                                                                                                                   Djitie Kouatcho

Télécharger la version pdf ici : tpe-biomol-2015-sbfsun.pdf

Posted in Exerxices, Cours | Réagir »



Créer un Blog | Nouveaux blogs | Top Tags | 76 articles | blog Gratuit | Abus?